Arf

Lemon Snake: Hello Bro, 1992 Toyota timing belt cover combining 36 materials and elements whilst only having three metric kilotonnes of cranium boltage.

AHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH!!!!!!!!!!!!!!!!!!!!!!!!!

Please Please Please do not eat lettuce is is mandated by the government

☺☺☺♥♥♥

Do. you believe in Wunna

ROFL:ROFL:ROFL:ROFL
_^___
L __/ [] \
LOL===__ \
L \________]
I I
--------/

mi tink mi gwan have a happy day

Hello! I couldn't reach you in private, so here's the answer to your question: No, it's not normal to have an inflammation in the anus area after intense penetration

Keel

orange

this man can fart

i think everyone wishes humans had tails, like imagine the moms at walmart saying "omg your hair is so pretty ;3" then you'd say thanks with a straight face but if we had a tail that shi would be waggin so fast. then she will notice and be like "aww look at you getting all excited for mommy" then youd styart to blush and get all embarassed and shi x3... you feelin me on this one?

edy's genetic sequence doxxd vvv

ATGCTCTTAGGTTCTAGATCTATGGAACTCATCG

walka texas ranga

HAPPY BIRTHDAY

happy birthday my voluptuous slime

edykickadoorandswitchyoudown

Simeon
Grab these vehicles: Benefactor Feltzer, Ocelot Jackal,
Ocelot F620, Enus Super Diamond, Obey Rocoto.

Stop calling me turtle stupid buffoon.

Hello ive came across your profile i was severely offended.

the worms are here

feel my passion feel my power 👽

ohio gyatt

skibidi toilet

bozo ☝🚩❌❌❌😂😂

Haha u aint even make it in the clan playa stop twiddlin wit yo thumbs and hit some shots off carrier

if i shoot you then youre in the clan sorry bro you didnt make it into the clan

Bottom Drawer - When entering the bank from the bus side, hug the right side, and look down on the left. You will see two keys in a drawer, low to the ground. See "sharing points" for more depth.
NAV table - In the back alley across from the turbine door, it is the power box and it would be leaning up

ill show u stupendous NGL nvm yk what i take that back playa gah DAYUUUUUUUUUUUUUUUUUUUM U GOT THE щшфо ащвшыаофЩво длыфартфоыдвло фщшсмчояащшфыаоЩШ Арашщфыо AND THE تبخشهسيتشسخهبته(pouch)تلخهبيس لتهسيخبتخسه

In 2016 edy and I dumped over 1500 lbs of garbage and used car batteries into the mariana trench for the department of defense when we were off deployment in guam

Dear king neptune

sket

Young Stroker the Body Snatcher will be joining you along your route. You're still on schedule to arrive by 7:54 or earlier.

𓅂𓂧𓅃𓄿𓂋𓂧𓇋𓎢𓅲𓋴

I hope when your in your ♥♥♥♥♥♥♥ car minding your own ♥♥♥♥♥♥♥ businesses thinking on the freeway wow what a nice day then BOOM you get ♥♥♥♥♥♥♥ t boned spine broke you cannot ♥♥♥♥♥♥♥ move gas leakin they cant get you out not even the life of jaws can get you out then you start smelling ♥♥♥♥♥♥♥ fire then someone yells out run then you notice the flame getting bigger THEN BOOM the whole ♥♥♥♥♥♥♥ car ♥♥♥♥♥♥♥ explodes , it explodes so ♥♥♥♥♥♥♥ bad they cannot ♥♥♥♥♥♥♥ identify you at all burnt to ♥♥♥♥♥♥♥ crisp no funeral no nothing ♥♥♥♥♥♥♥♥♥♥♥♥

ken carson

Salutations, what a stupendous profile

When I was 8 my dad made me watch black hawk down bc I didn't want to mow the lawn and he didn't let me speak the whole movie and he made me hold his colt 727 the whole time then during the closing credits he yelled "Do you know what those men would've done to mow their lawn again just one more time"

do u mess with tape worms

When the the When the the them Wait what was I typing why am I commenting on Edy's profile, who is Edy? Laundry I am doing my laundry Hello? Hellooooo? Yes I'm here What? Who is here? What are you on about I never asked if someone was there

Wisdom for the System:
Found a cult of billionaires.
Gaslight the ♥♥♥♥ out of the local Schizophrenic.
Tell a guy to kill people.
He actually starts doing it.

"Is that ham processed? If it's processed I don't want it."

Ma'am, that is an eleven pound whole slab of deli ham. It has no bones, fat, or connective tissue. It is an amalgamation of the meat of several pigs, emulsified, liquefied, strained, and ultimately inexorably joined in an unholy meat obelisk. God had no hand in the creation of this abhorrence. The fact that this ham monolith exists proves that God is either impotent to alter His universe or ignorant to the horrors taking place in his kingdom. This prism of pork is more than deli meat. It is a physical declaration of mankind's contempt for the natural order. It is hubris manifest. We also have a lower sodium variety if you would prefer that.

here to order 1 king von burger with the side of the g herbo mcnuggets along with a lil durk plushie

on February 10th, I was hospitalized indefinitely and on an emergency basis for severe third degree burns after spilling an entire pot of boiling hot Velveeta cheese on my lap, melting my skin, and searing open my femoral arteries. Due to my incredibly unique bloodtype, I've been unable to find a donor and so I am living off of plasma that cannot sustain me for a long duration of time. All I ask of you is to please temporarily relinquish a spot on your friends list for me so I can play with you one last time, as I do not have long on this Earth.

u mess wit doodie lo :interrobang:

KOSOVO IS ALBANIA!!!!!

now playing:

destroy lonely - if looks could kill
0:01 ❍——————————- 4:28
↻ ⊲ Ⅱ ⊳ ↺

serb

If you have a sensation of heat or burning in your penis, it could be the result of an infection such as a UTI, a yeast infection, or gonorrhea. Another cause of hot penis could be summer penile syndrome, but this shouldn't be confused with summer penis, which isn't a recognized medical condition